Stem-loop sequence gga-mir-6543

AccessionMI0022539 (change log)
DescriptionGallus gallus miR-6543 stem-loop
Stem-loop
   --------ccauuc    uu  c    -   u  u         aa  u    -ac  c 
5'               ccuu  gu cugu ugc gu accugagag  ga gcug   uc c
                 ||||  || |||| ||| || |||||||||  || ||||   || u
3'               ggaa  cg gacg aug ca uggacuuuc  cu cgac   ag c
   uccgagucccuucu    -u  c    g   u  c         --  c    acc  c 
Get sequence
Deep sequencing
128 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 133686509-133686616 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6543
gga-mir-1552chr1: 133682276-133682358 [+]
gga-mir-6543chr1: 133686509-133686616 [+]
Database links

Mature sequence gga-miR-6543-5p

Accession MIMAT0025826
Sequence

21 - 

gcuguuaccugagagaagaugcug

 - 44

Get sequence
Deep sequencing87 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6543-3p

Accession MIMAT0025827
Sequence

61 - 

gccuccuuucaggucacu

 - 78

Get sequence
Deep sequencing30 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).