Stem-loop sequence gga-mir-6563

AccessionMI0022543 (change log)
DescriptionGallus gallus miR-6563 stem-loop
Stem-loop
   --    ------     c        -c   ug    -gu         --a     uua 
5'   agcu      acuga ugcugcau  agu  gucg   ugugcuuag   gaugu   u
     ||||      ||||| ||||||||  |||  ||||   |||||||||   |||||    
3'   ucga      ugacu acgacgua  ucg  cagu   acacggguc   cugua   u
   cc    cuucau     c        ca   gu    guc         acc     cuu 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6563-5p

Accession MIMAT0025834
Sequence

21 - 

guuggucgguugugcuuagaga

 - 42

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6563-3p

Accession MIMAT0025835
Sequence

61 - 

acugggcacacugugacuggcuac

 - 84

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).