Stem-loop sequence gga-mir-6599

AccessionMI0022544 (change log)
DescriptionGallus gallus miR-6599 stem-loop
Literature search

1 open access papers mention gga-mir-6599
(1 sentences)

Stem-loop
   cag   c -         ---   a      g ucc      - u uga gg 
5'    agg g gugcuggga   gcg agggag c   gguccg c c   g  c
      ||| | |||||||||   ||| |||||| |   |||||| | |   |   
3'    ucc c cgcggcccu   cgc ucccuc g   cuaggc g g   c  a
   ---   a a         ccu   c      g -uc      a u uag ac 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 5100494-5100590 [-]
sense
ENSGALT00000004555 ; gga-mir-6599-201; 5'UTR (exon 1)
Database links

Mature sequence gga-miR-6599-5p

Accession MIMAT0025836
Sequence

21 - 

aagggaggcuccgguccgcucuga

 - 44

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6599-3p

Accession MIMAT0025837
Sequence

57 - 

ugacggauccuggcucccuccg

 - 78

Get sequence
Deep sequencing18 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).