Stem-loop sequence mmu-mir-6915

AccessionMI0022762 (change log)
Symbol MGI:Mir6915
DescriptionMus musculus miR-6915 stem-loop
Stem-loop
   aagaca  u  -   ca  u       c    uauuu 
5'       gg ca gag  ga ggagguu gugg     c
         || || |||  || ||||||| ||||      
3'       cc gu cuc  cu ccuucaa cacu     u
   ----ga  c  g   --  u       c    cccac 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128388832-128388900 [+]
sense
OTTMUST00000091849 ; Ankrd52-001; intron 21
ENSMUST00000014642 ; Ankrd52-001; intron 21
Clustered miRNAs
< 10kb from mmu-mir-6915
mmu-mir-6914chr10: 128382838-128382906 [+]
mmu-mir-6915chr10: 128388832-128388900 [+]
Database links

Mature sequence mmu-miR-6915-5p

Accession MIMAT0027730
Sequence

6 - 

aggucagagcagauggagguucgu

 - 29

Get sequence
Deep sequencing40 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6915-3p

Accession MIMAT0027731
Sequence

48 - 

caacuuccuuccucgugcccag

 - 69

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).