Stem-loop sequence ccr-let-7a

AccessionMI0023297 (change log)
DescriptionCyprinus carpio let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

8 open access papers mention ccr-let-7a
(51 sentences)

Stem-loop
   uguu     au   g   u             uagaguuac 
5'     ucggg  gag uag agguuguauaguu         a
       |||||  ||| ||| |||||||||||||         a
3'     agccc  uuc auc uccgacaugucaa         c
   ----     cu   g   c             uagagggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-let-7a

Accession MIMAT0026189
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).