Stem-loop sequence ccr-let-7b

AccessionMI0023298 (change log)
DescriptionCyprinus carpio let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention ccr-let-7b
(32 sentences)

Stem-loop
   a   u                     ucaggguagugauu 
5'  ggg gagguaguagguugugugguu              u
    ||| |||||||||||||||||||||              u
3'  ccc uuccgucauccaacauaucaa              g
   -   -                     uagaggacuacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-let-7b

Accession MIMAT0026190
Sequence

5 - 

ugagguaguagguugugugguu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).