Stem-loop sequence ccr-let-7i

AccessionMI0023300 (change log)
DescriptionCyprinus carpio let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention ccr-let-7i
(31 sentences)

Stem-loop
   ----uu      u        u    u            u    g  ggga      au 
5'       uagccg guacuggc gagg aguaguuugugc guug uu    ugugac  u
         |||||| |||||||| |||| |||||||||||| |||| ||    ||||||  g
3'       auuggu cgugaccg uucc ucaucgaacgcg cagu ag    guauug  c
   ucucac      -        -    c            u    -  --ag      cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-let-7i

Accession MIMAT0026192
Sequence

18 - 

ugagguaguaguuugugcugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).