Stem-loop sequence ccr-let-7j

AccessionMI0023301 (change log)
DescriptionCyprinus carpio let-7j stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention ccr-let-7j
(31 sentences)

Stem-loop
   cu         u        u            --------uu      cu u 
5'   gcucugggu gagguagu guuuguacaguu          uagggu  g u
     ||||||||| |||||||| ||||||||||||          ||||||  | a
3'   ugggacccg uuccguca cagacaugucaa          gucccg  c u
   --         -        u            uugaggaauu      -u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-let-7j

Accession MIMAT0026193
Sequence

12 - 

ugagguaguuguuuguacaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).