Stem-loop sequence ccr-mir-107

AccessionMI0023307 (change log)
DescriptionCyprinus carpio miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

1 open access papers mention ccr-mir-107
(1 sentences)

Stem-loop
   -ac  u       c   --   u  u          u    ugg a 
5'    uc gugugcu uga  gcu cu uacaguguug cuug   c u
      || ||||||| |||  ||| || |||||||||| ||||   | g
3'    ag cacacga acu  cgg ga auguuacgac gaac   g g
   aca  u       c   au   -  c          -    -ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-107

Accession MIMAT0026199
Sequence

53 - 

agcagcauuguacagggcuauc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).