Stem-loop sequence ccr-mir-122

AccessionMI0023311 (change log)
DescriptionCyprinus carpio miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

3 open access papers mention ccr-mir-122
(9 sentences)

Stem-loop 
   ca     ag c      uuu   uc u    --uuucua   ugu 
5'   aaaca  g ugucac   cuc  c guuc        gac   c
     |||||  | ||||||   |||  | ||||        |||   a
3'   uuugu  u acagug   gag  g cgag        cug   u
   --     gg a      --u   gu u    uccuccug   ucu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-122

Accession MIMAT0026203
Sequence

67 -  

uggagugugacaaugguguuu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).