Stem-loop sequence ccr-mir-137

AccessionMI0023323 (change log)
DescriptionCyprinus carpio miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

2 open access papers mention ccr-mir-137
(2 sentences)

Stem-loop
   uaaaa            ug   g           ug a     -  g 
5'      gacucucuucgg  acg guauucuuggg  g uaaua cg c
        ||||||||||||  ||| |||||||||||  | ||||| || u
3'      cugagaggagcu  ugc cauaagaauuc  u auugu gc c
   -----            ga   g           gu -     u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-137

Accession MIMAT0026217
Sequence

56 - 

uuauugcuuaagaauacgcguag

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).