Stem-loop sequence ccr-mir-181a

AccessionMI0023343 (change log)
DescriptionCyprinus carpio miR-181a stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention ccr-mir-181a
(15 sentences)

Stem-loop 
       uca   u a           ug      a    g aac 
5' cgag   cag g acauucaacgc  ucggug guuu c   u
   ||||   ||| | |||||||||||  |||||| |||| |    
3' gcuc   guc c ugugaguugug  agcuac caaa g   g
       ccc   c a           --      -    - aga
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-181a

Accession MIMAT0026238
Sequence

13 -  

aacauucaacgcugucgguga

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).