Stem-loop sequence ccr-mir-192

AccessionMI0023354 (change log)
DescriptionCyprinus carpio miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

3 open access papers mention ccr-mir-192
(3 sentences)

Stem-loop
   ----cc      -------c     --c     gu a  a     -          c    guuug 
5'       cagugu        uagga   acagg  g ug ccuau gaauugacag cagu     c
         ||||||        |||||   |||||  | || ||||| |||||||||| ||||      
3'       gucaca        auccu   ugucc  u ac ggaug cuugacuguc gucg     a
   cguuua      cacaaauc     auu     ug c  c     u          c    accug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-192

Accession MIMAT0026250
Sequence

24 - 

augaccuaugaauugacagcc

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).