Stem-loop sequence ccr-mir-27a

AccessionMI0023383 (change log)
DescriptionCyprinus carpio miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

3 open access papers mention ccr-mir-27a
(18 sentences)

Stem-loop
       u  a          cucu         gaucuc  a 
5' gagg gc ggacuuagcu    cugugaaca      gg u
   |||| || ||||||||||    |||||||||      ||  
3' cucc cg cuugaaucgg    gacacuugu      cc a
       u  c          ---u         ----au  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-27a

Accession MIMAT0026282
Sequence

50 - 

uucacaguggcuaaguuccgc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).