Stem-loop sequence ccr-mir-27c

AccessionMI0023384 (change log)
DescriptionCyprinus carpio miR-27c stem-loop
Gene family MIPF0000036; mir-27
Literature search

3 open access papers mention ccr-mir-27c
(13 sentences)

Stem-loop
   uucu        u   u   g      --------       c   u       cugcauu 
5'     uugcuggu gug ggu ucagga        cuuaacc acu gugaaca       g
       |||||||| ||| ||| ||||||        ||||||| ||| |||||||        
3'     aacgacua uac cca aguccu        gaauugg uga cacuugu       a
   ---a        -   -   g      accgucuu       -   -       uucuuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-27c-5p

Accession MIMAT0026283
Sequence

23 - 

caggacuuaacccacuugugaac

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-27c-3p

Accession MIMAT0026284
Sequence

65 - 

uucacagugguuaaguucugcc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).