Stem-loop sequence ccr-mir-30b

AccessionMI0023389 (change log)
DescriptionCyprinus carpio miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ccr-mir-30b
(9 sentences)

Stem-loop
   -uaaua       g      uu           a a       gua  cu 
5'       uuccagu uagucg  guaaacauccu c cucagcu   au  g
         ||||||| ||||||  ||||||||||| | |||||||   ||   
3'       gagguca gucagu  cguuuguggga g gggucgg   ua  c
   cuccuc       -      gu           g a       -ag  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-30b

Accession MIMAT0026289
Sequence

21 - 

uguaaacauccuacacucagcu

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).