Stem-loop sequence ccr-mir-30d

AccessionMI0023390 (change log)
DescriptionCyprinus carpio miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ccr-mir-30d
(9 sentences)

Stem-loop
   uucau u     u  uucau  cu          cc           ----g   u 
5'      g gcugg ug     gc  guaaacaucc  gacuggaagcu     ugc g
        | ||||| ||     ||  ||||||||||  |||||||||||     ||| u
3'      c ugacc gc     cg  cguuuguagg  uugacuuucga     acg a
   gcuuu u     u  --uac  -u          --           acaaa   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-30d

Accession MIMAT0026290
Sequence

24 - 

uguaaacauccccgacuggaagc

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).