Stem-loop sequence ccr-mir-499

AccessionMI0023407 (change log)
DescriptionCyprinus carpio miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

2 open access papers mention ccr-mir-499
(3 sentences)

Stem-loop
   ga     g    ua       c           gagaa 
5'   gggag cagu  agacuug agugauguuua     a
     ||||| ||||  ||||||| |||||||||||     u
3'   uccuc gucg  ucugaau ucacuacaagu     g
   -g     g    ug       u           acaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-499

Accession MIMAT0026309
Sequence

12 - 

uuaagacuugcagugauguuua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).