Stem-loop sequence ccr-mir-724

AccessionMI0023409 (change log)
DescriptionCyprinus carpio miR-724 stem-loop
Gene family MIPF0001616; mir-724
Literature search

3 open access papers mention ccr-mir-724
(3 sentences)

Stem-loop
         a u      -        uu  c a      -   ca 
5' cagcag c ggauuu aaagggaa  ug g cuguuu agu  c
   |||||| | |||||| ||||||||  || | |||||| |||   
3' gucguc g ucuaga uuuuccuu  ac c gacaaa uua  a
         c u      a        cc  a c      a   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-724

Accession MIMAT0026311
Sequence

14 - 

uuaaagggaauuugcgacuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).