Stem-loop sequence ccr-mir-725

AccessionMI0023410 (change log)
DescriptionCyprinus carpio miR-725 stem-loop
Literature search

1 open access papers mention ccr-mir-725
(1 sentences)

Stem-loop
   c         a             c           gaac 
5'  cugcagugc cacugcuaggaau guggcugagau    a
    ||||||||| ||||||||||||| |||||||||||     
3'  gacgucgcg gugaugaucuuug uacugacuuua    g
   -         g             u           ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-725

Accession MIMAT0026312
Sequence

49 - 

uucagucauuguuucuaguagu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).