Stem-loop sequence ccr-mir-734

AccessionMI0023415 (change log)
DescriptionCyprinus carpio miR-734 stem-loop
Gene family MIPF0001543; mir-734
Literature search

1 open access papers mention ccr-mir-734
(1 sentences)

Stem-loop
   auccuu      ug     u a  c            ggc     gugga   u 
5'       ugauau  agagc g ac guucugcagcau   ugccu     ucc c
         ||||||  ||||| | || ||||||||||||   |||||     ||| u
3'       acuaug  ucuug c ug uaagacgucgua   augga     agg g
   -----c      gu     c a  c            --a     ----a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-734

Accession MIMAT0026318
Sequence

66 - 

uaaaugcugcagaaucguaccg

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).