Stem-loop sequence ccr-mir-7a

AccessionMI0023416 (change log)
DescriptionCyprinus carpio miR-7a stem-loop
Gene family MIPF0000022; mir-7
Literature search

4 open access papers mention ccr-mir-7a
(4 sentences)

Stem-loop
          g   cau  a     a       u      -------   a 
5' auuuugg cac   gg agacu gugauuu guuguu       gug a
   ||||||| |||   || ||||| ||||||| ||||||       |||  
3' uaagacc gug   cc ucuga cacugaa caacag       cac g
          a   acu  g     -       -      ucguggc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-7a

Accession MIMAT0026319
Sequence

14 - 

uggaagacuagugauuuuguuguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).