Stem-loop sequence bma-mir-5880b

AccessionMI0023492 (change log)
DescriptionBrugia malayi miR-5880b stem-loop
Gene family MIPF0001483; mir-5880
Stem-loop
   ---             c                  aaca  u 
5'    uguccaaguuuga cuaacaaguuaccgaugu    gu u
      ||||||||||||| ||||||||||||||||||    ||  
3'    acagguucaaacu gauuguuuaauggcugca    cg u
   ucu             a                  --ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold24: 278000-278080 [-]
intergenic
Clustered miRNAs
< 10kb from bma-mir-5880b
bma-mir-5880aBmal_v3_scaffold24: 278001-278082 [+]
bma-mir-5880bBmal_v3_scaffold24: 278000-278080 [-]
Database links

Mature sequence bma-miR-5880b

Accession MIMAT0026381
Sequence

49 - 

gucgguaauuuguuagaucaaac

 - 71

Get sequence
Evidence not experimental

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).