Stem-loop sequence gga-mir-6608-2

AccessionMI0023553 (change log)
DescriptionGallus gallus miR-6608-2 stem-loop
Gene family MIPF0001600; mir-6608
Stem-loop
   ugg   --   gg       ag    a  g         -ac      c    ugu 
5'    ccu  gau  ggaauga  auga cu uucuuccuc   cagugc ucag   u
      |||  |||  |||||||  |||| || |||||||||   |||||| ||||   g
3'    gga  cug  ucuuacu  uacu ga gagagggag   gucacg aguu   a
   caa   cc   uu       gg    a  -         aac      -    gaa 
Get sequence
Deep sequencing
4280 reads, 567 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 65895167-65895276 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6608-2
gga-mir-6608-1chr1: 65891957-65892066 [+]
gga-mir-6608-2chr1: 65895167-65895276 [+]
Database links

Mature sequence gga-miR-6608-5p

Accession MIMAT0025702
Sequence

6 - 

ugauggggaaugaagaugaa

 - 25

Get sequence
Deep sequencing66 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6608-3p

Accession MIMAT0025703
Sequence

63 - 

agcacugcaagagggagagagau

 - 85

Get sequence
Deep sequencing7800 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).