Stem-loop sequence gga-mir-6646-2

AccessionMI0023554 (change log)
DescriptionGallus gallus miR-6646-2 stem-loop
Gene family MIPF0001490; mir-6646
Stem-loop
   u       --gcagcucaga      cu    c                    guu 
5'  gcagccc            uucugc  uucu ccagcugcugccaucaggac   g
    |||||||            ||||||  |||| ||||||||||||||||||||    
3'  ugucggg            aggacg  agga ggucgacgaugguggucuug   c
   -       aacaacccuaga      -u    a                    gac 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6646-3p

Accession MIMAT0025743
Sequence

62 - 

ucuggugguagcagcuggaagg

 - 83

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).