Stem-loop sequence gga-mir-6648-2

AccessionMI0023555 (change log)
DescriptionGallus gallus miR-6648-2 stem-loop
Gene family MIPF0001557; mir-6648
Stem-loop
   -g  ga   ua   ------- g                        -u   a 
5'   cg  ggc  cgg       g guaaaggagcguucagaaugccgg  ggc g
     ||  |||  |||       | ||||||||||||||||||||||||  |||  
3'   gu  ucg  guu       c cauuuccucgcaagucuuacggcc  ccg c
   ga  gg   gg   aguggga g                        uc   u 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
KQ759460.1: 17716-17814 [-]
sense
Database links

Mature sequence gga-miR-6648-5p

Accession MIMAT0025746
Sequence

20 - 

aggagcguucagaaugccggug

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6648-3p

Accession MIMAT0025747
Sequence

52 - 

uccggcauucugaacgcuccu

 - 72

Get sequence
Deep sequencing432 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).