Stem-loop sequence ssc-mir-7134

AccessionMI0023567 (change log)
DescriptionSus scrofa miR-7134 stem-loop
Literature search

2 open access papers mention ssc-mir-7134
(5 sentences)

Stem-loop
   --a              c     -  gg  g 
5'    uguccgcggguucc uaucc cg  uu g
      |||||||||||||| ||||| ||  || u
3'    auaggcguccaagg guagg gc  ga u
   ggc              c     c  uu  g 
Get sequence
Deep sequencing
806 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 5388521-5388582 [+]
antisense
Database links

Mature sequence ssc-miR-7134-5p

Accession MIMAT0028143
Sequence

1 - 

auguccgcggguucccuaucc

 - 21

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-7134-3p

Accession MIMAT0028144
Sequence

42 - 

augcggaaccugcggauacgg

 - 62

Get sequence
Deep sequencing801 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).