Stem-loop sequence ssc-mir-7140

AccessionMI0023573 (change log)
DescriptionSus scrofa miR-7140 stem-loop
Literature search

1 open access papers mention ssc-mir-7140
(2 sentences)

Stem-loop
   ---      a                uucau 
5'    caacuc agggggcaucauucac     a
      |||||| ||||||||||||||||      
3'    guugag uuccccguaguaagug     g
   cga      a                ucucu 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 39852404-39852464 [+]
antisense
chr17: 40148186-40148246 [+]
antisense
chrUScaf1324: 126746-126806 [+]
antisense
Database links

Mature sequence ssc-miR-7140-5p

Accession MIMAT0028155
Sequence

1 - 

caacucaagggggcaucauuca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7140-3p

Accession MIMAT0028156
Sequence

40 - 

augaugccccuuagaguugagc

 - 61

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).