Stem-loop sequence dre-mir-7146

AccessionMI0023605 (change log)
DescriptionDanio rerio miR-7146 stem-loop
Literature search

2 open access papers mention dre-mir-7146
(2 sentences)

Stem-loop
            a  -   a   u   a  u    u    c               c     uauuug 
5' gacagaaaa ga gau uuu gaa aa guug aagc gguaaccauugaccu cauag      u
   ||||||||| || ||| ||| ||| || |||| |||| ||||||||||||||| |||||      u
3' uuguuuuuu cu cua aag cuu uu cgac uuug ccauugguaacugga guauu      u
            -  a   c   u   c  u    u    a               a     gucccu 
Get sequence
Deep sequencing
1600 reads, 7.07e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr20: 5074924-5075054 [+]
sense
OTTDART00000004466 ; ccnk-001; intron 1
ENSDART00000142518 ; ccnk-001; intron 1
ENSDART00000048204 ; ccnk-201; intron 1
ENSDART00000104581 ; ccnk-202; intron 1
Database links

Mature sequence dre-miR-7146-5p

Accession MIMAT0028203
Sequence

39 - 

guaaccauugaccuccauagu

 - 59

Get sequence
Deep sequencing270 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence dre-miR-7146-3p

Accession MIMAT0028204
Sequence

77 - 

ugaaggucaaugguuaccaguu

 - 98

Get sequence
Deep sequencing1325 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).