Stem-loop sequence dre-mir-7148

AccessionMI0023607 (change log)
DescriptionDanio rerio miR-7148 stem-loop
Literature search

1 open access papers mention dre-mir-7148
(2 sentences)

Stem-loop
                a          c   g      caagaa 
5' gcuaauacuagua uggaaauacu gcu auacug      u
   ||||||||||||| |||||||||| ||| ||||||      u
3' ugguuaugaucau gccuuuauga cga uauggc      g
                a          c   a      uacggu 
Get sequence
Deep sequencing
210 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 57103401-57103485 [-]
sense
ENSDART00000098562 ; slc25a42-201; intron 1
Database links

Mature sequence dre-miR-7148-5p

Accession MIMAT0028206
Sequence

14 - 

auggaaauacucgcugauacug

 - 35

Get sequence
Deep sequencing207 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence dre-miR-7148-3p

Accession MIMAT0028207
Sequence

54 - 

uauaagccaguauuuccgau

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).