Stem-loop sequence dre-mir-7149

AccessionMI0023608 (change log)
DescriptionDanio rerio miR-7149 stem-loop
Stem-loop
          g   a  -cu     -      uuga  u 
5' agaaacu uga uc   acacu ggaagg    ug u
   ||||||| ||| ||   ||||| ||||||    || u
3' ucuuuga acu ag   uguga ccuucu    ac u
          a   g  uau     a      cuug  a 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24074083-24074155 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-7149
dre-mir-200bchr23: 24072029-24072110 [+]
dre-mir-200achr23: 24072160-24072245 [+]
dre-mir-429achr23: 24073815-24073896 [+]
dre-mir-7149chr23: 24074083-24074155 [+]
Database links

Mature sequence dre-miR-7149-5p

Accession MIMAT0028208
Sequence

7 - 

ugugaauccuacacuggaagg

 - 27

Get sequence
Deep sequencing47 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence dre-miR-7149-3p

Accession MIMAT0028209
Sequence

47 - 

uuccaaguguuaugagucaaagu

 - 69

Get sequence
Deep sequencing23 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).