Stem-loop sequence dre-mir-1306

AccessionMI0023609 (change log)
DescriptionDanio rerio miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Literature search

1 open access papers mention dre-mir-1306
(2 sentences)

Stem-loop
   --    c    u  ccu  a        g ga g 
5'   ucca cacc cc   gc aacgucca u  c c
     |||| |||| ||   || |||||||| |  | a
3'   aggu gugg gg   cg uugcaggu a  g g
   ac    a    u  ucu  a        a ag a 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 24521682-24521750 [+]
sense
OTTDART00000019413 ; dgcr8-001; 3'UTR (exon 2)
ENSDART00000124915 ; dgcr8-202; 3'UTR (exon 1)
ENSDART00000051554 ; dgcr8-201; 3'UTR (exon 1)
ENSDART00000117697 ; dre-mir-1306.1-201; exon 1
ENSDART00000144560 ; dgcr8-001; 3'UTR (exon 2)
KZ115113.1: 217685-217753 [+]
sense
OTTDART00000019413 ; dgcr8-001; 3'UTR (exon 2)
ENSDART00000124915 ; dgcr8-202; 3'UTR (exon 1)
ENSDART00000051554 ; dgcr8-201; 3'UTR (exon 1)
ENSDART00000117697 ; dre-mir-1306.1-201; exon 1
ENSDART00000144560 ; dgcr8-001; 3'UTR (exon 2)
Database links

Mature sequence dre-miR-1306

Accession MIMAT0028210
Sequence

5 - 

ccaccuccccugcaaacgucca

 - 26

Get sequence
Deep sequencing21 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).