Stem-loop sequence mdo-mir-128b

AccessionMI0023827 (change log)
DescriptionMonodelphis domestica miR-128b stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --c       uag      cu       u 
5'    ggggccg   cacugu  gagaggu u
      |||||||   ||||||  |||||||  
3'    cucuggc   gugaca  cucuuua a
   uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 132653246-132653301 [+]
sense
ENSMODT00000028333 ; mdo-mir-128b-201; exon 1
ENSMODT00000001123 ; R3HDM1-201; intron 20
Database links

Mature sequence mdo-miR-128b-5p

Accession MIMAT0028608
Sequence

1 - 

cggggccguagcacugucugaga

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-128b-3p

Accession MIMAT0028609
Sequence

36 - 

ucacagugaaccggucucuuu

 - 56

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).