Stem-loop sequence oan-let-7c-1

AccessionMI0024053 (change log)
DescriptionOrnithorhynchus anatinus let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   g   u             ua  g  a ac 
5'    gag uag agguuguaugguu  ga uc c  c
      ||| ||| |||||||||||||  || || |   
3'    uuc auc uccaacaugucaa  uu ag g  c
   ccu   g   u             --  g  - gc 
Get sequence
Deep sequencing
10911776 reads, 1.83e+05 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig166952: 114-180 [-]
sense
ENSOANT00000026225 ; oan-let-7c-2-201; exon 1
Database links

Mature sequence oan-let-7c-5p

Accession MIMAT0028958
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Deep sequencing21821418 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7c-3p

Accession MIMAT0028959
Sequence

46 - 

cuguacaaccuucuagcuuucc

 - 67

Get sequence
Deep sequencing2082 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).