Stem-loop sequence aja-let-7i

AccessionMI0024373 (change log)
DescriptionArtibeus jamaicensis let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-let-7i

Accession MIMAT0031151
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).