Stem-loop sequence lja-MIR171a

AccessionMI0024377 (change log)
DescriptionLotus japonicus miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention lja-MIR171a
(8 sentences)

Stem-loop
             uau  c         u       c     --       c   -----ca    g 
5' augaaguagc   ug gauauuggc ugguuca ucaga  caaaaca aua       caca a
   ||||||||||   || ||||||||| ||||||| |||||  ||||||| |||       |||| a
3' uacuucaucg   ac cuauaaccg gccgagu aguuu  guuuugu uau       gugu a
             -uc  u         u       u     ug       a   auauuag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr2: 26398110-26398232 [-]
intergenic
Clustered miRNAs
< 10kb from lja-MIR171a
lja-MIR11111Chr2: 26398948-26399132 [+]
lja-MIR171aChr2: 26398110-26398232 [-]
Database links

Mature sequence lja-miR171a

Accession MIMAT0029314
Sequence

88 - 

ugauugagccgugccaauauc

 - 108

Get sequence
Evidence not experimental

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).