Stem-loop sequence lja-MIR171b

AccessionMI0024378 (change log)
DescriptionLotus japonicus miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention lja-MIR171b
(8 sentences)

Stem-loop
     a    uuaa               u       u  ag     gc   cuaac 
5' gc caaa    caagguauugacgcg cucaauu ga  acaug  ugg     a
   || ||||    ||||||||||||||| ||||||| ||  |||||  |||      
3' ug guuu    guucuauaacugcgc gaguuag uu  uguac  acc     u
     c    --uc               c       u  ga     ua   aaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr6: 26439979-26440086 [-]
intergenic
Database links

Mature sequence lja-miR171b

Accession MIMAT0029315
Sequence

76 - 

ugauugagccgcgucaauauc

 - 96

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).