Stem-loop sequence lja-MIR171c

AccessionMI0024379 (change log)
DescriptionLotus japonicus miR171c stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

2 open access papers mention lja-MIR171c
(10 sentences)

Stem-loop
          --c     u  c           c        auuu    --     u 
5' gcaaaag   agaca gg gugauguugau uggcucau    aagu  auaag g
   |||||||   ||||| || ||||||||||| ||||||||    ||||  ||||| u
3' cguuuuu   ucugu uc cacuauaacua gccgagua    uuca  uauuc a
          ucu     -  u           a        -gac    ac     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lja-miR171c

Accession MIMAT0029316
Sequence

71 - 

ugagccgaaucaauaucacuc

 - 91

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).