Stem-loop sequence lja-MIR172a

AccessionMI0024381 (change log)
DescriptionLotus japonicus miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention lja-MIR172a
(2 sentences)

Stem-loop
       g  g                a    cu        ug     uguu     ug  c 
5' gcug ug agcaucaucaagauuc caag  uuaagggg  gauug    ugggg  gu c
   |||| || |||||||||||||||| ||||  ||||||||  |||||    |||||  || c
3' cgau ac ucguaguaguucuaag guuu  aguuucuc  uuaac    accuc  ua u
       g  g                a    --        gu     -uau     gu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lja-miR172a

Accession MIMAT0029319
Sequence

96 - 

agaaucuugaugaugcugcag

 - 116

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).