Stem-loop sequence lja-MIR172b

AccessionMI0024382 (change log)
DescriptionLotus japonicus miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention lja-MIR172b
(2 sentences)

Stem-loop
          auuu  a                     a   -g    ugcaaaugcaaucua 
5' ggucguu    gc gauguagcaucaucaagauuc cau  caaa               a
   |||||||    || ||||||||||||||||||||| |||  ||||               g
3' ucggcaa    cg cuacgucguaguaguucuaag gug  guuu               g
          guac  a                     a   aa    ucuagauaccgaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr3: 41190704-41190825 [+]
intergenic
Database links

Mature sequence lja-miR172b

Accession MIMAT0029320
Sequence

87 - 

agaaucuugaugaugcugca

 - 106

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).