Stem-loop sequence lja-MIR172c

AccessionMI0024383 (change log)
DescriptionLotus japonicus miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention lja-MIR172c
(2 sentences)

Stem-loop
          guc   a         c           ---    a    uuau 
5' agucguu   ugc ggugcagca caucaagauuc   acac caaa    a
   |||||||   ||| ||||||||| |||||||||||   |||| ||||     
3' uuagcaa   acg cuacgucgu guaguucuaag   ugug guuu    a
          aua   a         a           agu    -    ugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr5: 28691229-28691328 [+]
intergenic
Database links

Mature sequence lja-miR172c

Accession MIMAT0029321
Sequence

65 - 

agaaucuugaugaugcugca

 - 84

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).