Stem-loop sequence lja-MIR390b

AccessionMI0024385 (change log)
DescriptionLotus japonicus miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

1 open access papers mention lja-MIR390b
(10 sentences)

Stem-loop
          a  u    a          g         ca    u  ucu     u uu   u 
5' gugugga aa cugu aagcucagga ggauagcgc  ugga gg   ggauc c  gca u
   ||||||| || |||| |||||||||| |||||||||  |||| ||   ||||| |  ||| a
3' cauacuu uu ggua uuugaguccu ccuaucgcg  aucu cu   ucuag g  ugu u
          c  c    c          a         --    -  ---     u -u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr3: 17662578-17662695 [-]
intergenic
Database links

Mature sequence lja-miR390b-5p

Accession MIMAT0029324
Sequence

17 - 

aagcucaggagggauagcgcc

 - 37

Get sequence
Evidence experimental; cloned [1], Northern [1]

Mature sequence lja-miR390b-3p

Accession MIMAT0029325
Sequence

84 - 

cgcuauccauccugaguuuca

 - 104

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).