Stem-loop sequence lja-MIR397

AccessionMI0024386 (change log)
DescriptionLotus japonicus miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

1 open access papers mention lja-MIR397
(15 sentences)

Stem-loop
        -   -   uuguaaauuc        --gau      u                     guccugaacugcauugugc 
5' ucuca gau gaa          ccauauug     aaacau auugagugcagcguugaugaa                   u
   ||||| ||| |||          ||||||||     |||||| |||||||||||||||||||||                   a
3' agagu cua cuu          gguauaac     uuugua uaacucacgucgcagcuauuu                   u
        g   a   ----------        gauuu      c                     ucguaaaccgaagagggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr0: 31433003-31433157 [+]
intergenic
Database links

Mature sequence lja-miR397

Accession MIMAT0029326
Sequence

39 - 

uauugagugcagcguugauga

 - 59

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).