Stem-loop sequence lja-MIR408

AccessionMI0024387 (change log)
DescriptionLotus japonicus miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

1 open access papers mention lja-MIR408
(2 sentences)

Stem-loop
        -a        a   uga ag g   ag  aagu   ucuu        gacau   aa    -             a     ga        u       auaaa  gag 
5' auguu  uuuugcug ugu   c  g aug  cu    uga    gauggaga     gac  uggc agggaagaggcag gcaug  uggagcua caacaaa     uu   a
   |||||  |||||||| |||   |  | |||  ||    |||    ||||||||     |||  |||| ||||||||||||| |||||  |||||||| |||||||     ||    
3' uacaa  aagaugac aca   g  u uac  ga    acu    uugccucu     cug  accg ucccuuuuccguc cguac  aucucggu guuguuu     ag   a
        aa        -   uag au g   ga  --gu   --cu        -gacu   -c    g             a     uc        -       -gaag  ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr6: 16493676-16493896 [+]
intergenic
Database links

Mature sequence lja-miR408

Accession MIMAT0029327
Sequence

66 - 

cagggaagaggcagagcaugg

 - 86

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).