Stem-loop sequence lja-MIR1507a

AccessionMI0024389 (change log)
DescriptionLotus japonicus miR1507a stem-loop
Gene family MIPF0000699; MIR1507
Literature search

1 open access papers mention lja-MIR1507a
(6 sentences)

Stem-loop
        aau     g    -         c     a         g u    ug u 
5' aaggc   guuug uaga gguguaugg uggaa aaagaaaag c ucuc  g c
   |||||   ||||| |||| ||||||||| ||||| ||||||||| | ||||  |  
3' uuuug   caaac aucu cuacauacc accuu uuucuuuuc g agag  u a
        agu     a    a         u     c         - u    gu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr6: 14494730-14494839 [-]
intergenic
Database links

Mature sequence lja-miR1507a

Accession MIMAT0029330
Sequence

75 - 

ucuuccauccauacaucaucu

 - 95

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).