Stem-loop sequence ipu-let-7a-5

AccessionMI0024436 (change log)
DescriptionIctalurus punctatus let-7a-5 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7a-5
(6 sentences)

Stem-loop
   --u          gu         ---u g    -    au 
5'    gagguaguag  uguauaguu    g uggg aggg  c
      ||||||||||  |||||||||    | |||| ||||   
3'    uuccguuauc  acauaucaa    c acuu uccc  a
   ucc          ug         uagu g    g    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7a

Accession MIMAT0029374
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1