Stem-loop sequence ipu-let-7a-6

AccessionMI0024437 (change log)
DescriptionIctalurus punctatus let-7a-6 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7a-6
(6 sentences)

Stem-loop
   -u          gu         ---- g    a       
5'   gagguaguag  uguauaguu    u uggg aggauc 
     ||||||||||  |||||||||    | |||| ||||| a
3'   uuccguuauc  acauaucaa    g acuu uccuac 
   cc          ug         uagu g    a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7a

Accession MIMAT0029374
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1