Stem-loop sequence ipu-let-7a-4

AccessionMI0024438 (change log)
DescriptionIctalurus punctatus let-7a-4 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7a-4
(6 sentences)

Stem-loop
   --u   g   u             ---uaga  ua 
5'    gag uag agguuguauaguu       gu  c
      ||| ||| |||||||||||||       ||   
3'    uuc auc uccgacaugucaa       ca  a
   ccu   g   c             uagaggg  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7a

Accession MIMAT0029374
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1