Stem-loop sequence ipu-let-7b-2

AccessionMI0024440 (change log)
DescriptionIctalurus punctatus let-7b-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7b-2
(5 sentences)

Stem-loop
   --u                     ---  -----a      u 
5'    gagguaguagguugugugguu   uc      ggguag g
      |||||||||||||||||||||   ||      |||||| a
3'    uuccgucauccaacauaucaa   ag      cccguu u
   ccc                     uug  gacuac      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7b

Accession MIMAT0029375
Sequence

1 - 

ugagguaguagguuguguggu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1