Stem-loop sequence ipu-let-7c-1

AccessionMI0024442 (change log)
DescriptionIctalurus punctatus let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7c-1
(5 sentences)

Stem-loop
   --u   g   u             uag      gc 
5'    gag uag agguuguaugguu   aauuuu  c
      ||| ||| |||||||||||||   ||||||   
3'    uuc auc uccaacaugucaa   uugagg  c
   ccu   g   u             ---      gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7c

Accession MIMAT0029376
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1